Gene Information
Gene Name
|
4-1BB/CD137
|
Species
|
Rat
|
Gene Length
|
777 bp
|
Product Feature
|
Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 9provided.
|
Sequence Signature
|
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
|
Plasmid Information
Vector
|
pLV-C-GFPSpark®
|
Promoter
|
Enhanced CMV mammalian cell promoter
|
Tag Sequence
|
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
|
Sequencing Primer
|
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
|
Quality Control
|
The plasmid is confirmed by full-length sequencing.
|
Bacterial Screening Resistance
|
Ampicillin
|
Background
CD137 (also known as 4-1BB) is a surface co-stimulatory glycoprotein originally described as present on activated T lymphocytes, which belongs to the tumor necrosis factor (TNF) receptor superfamily. It is expressed mainly on activated CD4+ and CD8+ T cells, and binds to a high-affinity ligand (4-1BBL) expressed on several antigen-presenting cells such as macrophages and activated B cells. Upon ligand binding, 4-1BB is associated with the tumor necrosis factor receptor–associated factors (TRAFs), the adaptor protein which mediates downstream signaling events including the activation of NF-kappaB and cytokine production. 4-1BB signaling either by binding to 4-1BBL or by antibody ligation delivers signals for T-cell activation and growth, as well as monocyte proliferation and B-cell survival, and plays an important role in the amplification of T cell-mediated immune responses. In addition, CD137 and CD137L are expressed in different human primary tumor tissues, suggesting that they may influence the progression of tumors. Crosslinking of CD137 on activated T cells has shown promise in enhancing anti-tumor immune responses in murine models, and agonistic anti-CD137 antibodies are currently being tested in phase I clinical trials. Soluble forms of CD137 (sCD137) are generated by differential splicing. sCD137 can bind to CD137 ligand to antagonize the costimulatory activities of the membrane-bound CD137 and reduce T cell proliferation and IL-2 secretion.
Cancer Immunotherapy
Co-stimulatory Immune Checkpoint Targets
Immune Checkpoint
Immune Checkpoint Detection: Antibodies
Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets
Immunotherapy
Targeted Therapy