Gene Information
Gene Name
|
14-3-3 beta
|
Species
|
Mouse
|
Gene Length
|
741 bp
|
Product Feature
|
Full length Clone DNA of Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide.
|
Sequence Signature
|
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
|
Plasmid Information
Vector
|
pLV-C-GFPSpark®
|
Promoter
|
Enhanced CMV mammalian cell promoter
|
Tag Sequence
|
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
|
Sequencing Primer
|
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
|
Quality Control
|
The plasmid is confirmed by full-length sequencing.
|
Bacterial Screening Resistance
|
Ampicillin
|
Background
14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.